Abstract: Objective To detect pathologic fungi existed in experimental or clinical specimens. Methods A hot-initiated polymerase chain reaction (PCR)-based method with a set of universal fungus-specific primers that are capable of detecting a wide range of medically important fungi is developed in this paper. Such primers allow specific amplification of fungal DNA but not other eukaryotes or prokaryotes. The gene sequences are:①AACTTAAAGGAATTGACGGAAG;②GCATCACAGACCTGTTATTGCCTC. Results A 310bp product was successfully amplified from all 42 strains of 23 fungal species studied, and from 22 culture proved clinical specimens within 3 hours, but not from any strains of other microbes and human cells. This detection system is of high sensitivity. Conclusion This highly universal primer system in combinaition with highly specific hot-initiated PCR might be used in the detection of medically important fungi in experimental or clinical specimens.

Key words: Fungus, Polymerase chain reaction